RT‐PCR.Total nucleic acid was extracted from specimens by using the NucliSens easyMAG extraction system (bioMérieux) according to the manufacturer’s instructions. Twelve microliters of extracted nucleic acid was used to prepare complementary DNA (cDNA) by using an Invitrogen Superscript III kit (Invitrogen) with random primer, as described elsewhere.
For detection of influenza A virus, 2 μL of cDNA were amplified in a LightCycler 2.0 (Roche Diagnostics) with a total reaction‐mix volume of 20 μL reaction containing FastStart DNA Master SYBR Green I Mix reagent kit (Roche Diagnostics), 4.0 mM MgCl2, and 0.5 mM of each primer. The forward primer (5′‐CTTCTAACCGAGGTCGAAACG‐3′) and the reverse primer (5′‐GGCATTTTGGACAAAKCGTCTA‐3′) were used for amplification of the matrix gene of influenza A virus. Cycling conditions were as follows: an initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 10 sec, 60°C for 3 sec, 72°C for 12 sec with ramp rates of 20°C per sec. At the end of the assay, PCR products were subjected to a melting curve analysis to determine the specificity of the assay.
For detection of influenza B virus, forward (5′‐ GCATCTTTTGTTTTTTATCCATTCC) and reverse (5′‐CACAATTGCCTACCTGCTTTCA) primers and 5′ nuclease probe (Fam‐TGCTAGTTCTGCTTTGCCTTCTCCATCTTCT‐TAMRA) were used for amplification of the matrix gene [65]. Testing was performed using TaqMan EZ RT‐PCR Core reagent kit (Applied Biosystems) comprising 0.8 μmol/L of forward and reverse primers and 0.2 μmol/L of probe in a total reaction volume of 25 μL, comprising 4 μL of nucleic acid extract. Amplification and detection were performed on an ABI StepOne Real‐Time PCR System (Applied Biosystems) with the following conditions: initial hold at 50°C for 20 min and 95°C for 15 min followed by 45 cycles at 95°C for 15 sec and 60°C for 1 min.
Serological testing. The serum samples were treated with receptor‐destroying enzyme (RDE) (Denka Seiken) at 37°C overnight to remove nonspecific inhibitors, and residual RDE was destroyed by heat inactivation at 56°C for 30 min. The HAI test was performed in 96‐well microtiter plates using reagents provided by World Health Organization (WHO) Collaborating Centre for Reference and Research on Influenza (Melbourne, Australia) or the WHO Collaborating Centre, Centres for Disease Control and Prevention (Atlanta, GA) with use of standard methods as detailed in the WHO reagent kit and elsewhere [66]. The viruses used were A/Brisbane/59/2007 (H1N1), A/Brisbane/10/2007 (H3N2) like virus A/Uruguay/716/2007 virus and B/Florida/4/2006‐like (Yamagata‐lineage) virus antigens provided as part of the WHO reagents.
The conventional neutralization test for the A/California/4/2009 virus was performed in microtiter plates using neutralization of virus cytopathogenic effect in Madin‐Darby Canine Kidney (MDCK) cells. Serial serum dilutions in quadruplicate were mixed with 100 tissue culture 50% infectious doses of A/California/4/2009 (H1N1) virus for 2 h and added to MDCK cells. The plates were incubated, and cytopathic effect was observed to determine the highest serum dilution that neutralized 50% of the wells. A virus back titration and positive and negative control serum samples were included in each assay.